Run SRR000250 Download

CenterJGI
Instrument454 GS 20
Instrument nameno content
AliasD71UY5X
Experiment aliasFNNC
Referencesno content
OrganismMethanococcus voltae A3
SubmitterJoint Genome Institute, U.S. Department of Energy
Library nameFNNC
Library strategyWGS
Library sourceGENOMIC
Library selectionRANDOM
Library layoutSINGLE
Library construction protocolno content
Related objects
SubmissionsSRA000216
Linksno content
flow_count 168
flow_sequence TACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACG
key_sequence TCAG