Experiment SRX363877 Download

Title1135071706744 EX08W2 URT_EX08W2_02_V3V5 Experiment
Alias1135071706744 EX08W2 URT_EX08W2_02_V3V5 Experiment
Design description16S PCR followed by 454 sequencing
Referencesno content
OrganismsHomo sapiens
SubmitterJ. Craig Venter Institute
Instrument454 GS FLX Titanium
Library nameURT_EX08W2_02_V3V5
Library strategyAMPLICON
Library sourceMETAGENOMIC
Library selectionPCR
Library layoutSINGLE
Library construction protocolno content
Related objects
SubmissionsSRA106049
Linksno content
affection_status treated receiving vaccine
forward_primer AGAGTTTGATCCTGGCTCAG
gene 16SrRNA
Keywords GSC:MIMARKS
library_strategy targeted-locus
replicate 2
reverse_primer ATTACCGCGGCTGCTGG
sample_type Flu Mist human